Master the Repeated DNA Sequences LeetCode problem with undetectable real-time assistance. Get instant solutions and explanations during your coding interviews.
Phantom Code generates complete solutions and debugging hints that you can use while explaining your approach, so you stay calm and in control.
The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'. When studying DNA, it is useful to identify repeated sequences within the DNA. Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.
Phantom Code will help you solve this problem in real-time during your interview
Let's break down this LeetCode problem and understand what makes it challenging in interview settings.
The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'. When studying DNA, it is useful to identify repeated sequences within the DNA. Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.
Get real-time assistance for Repeated DNA Sequences problems during coding interviews. Phantom Code provides instant solutions and explanations.
s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
["AAAAACCCCC","CCCCCAAAAA"]
s = "AAAAAAAAAAAAA"
["AAAAAAAAAA"]
Reinforce undetectability, platform compatibility, and real-time assistance to remove any doubt.
Watch how Phantom Code helps solve LeetCode problems during live interviews
Solve Repeated DNA Sequences — The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C',...
Here's the optimal approach using Hash Table:
Time: O(n) | Space: O(n)
Thousands of developers use Phantom Code. Social proof signals that this approach helps real candidates land offers across a range of companies.
Our native desktop architecture avoids common detection vectors used by browser extensions. We provide a clear checklist so you can run basic checks and confirm the app will be invisible.
We work with Zoom, HackerRank, CodeSignal, CoderPad and other web-based platforms. Check the compatibility note and request a browser link if a specific desktop app is unsupported.
Common questions about solving Repeated DNA Sequences and using Phantom Code during coding interviews.
The only AI interview tool with an undetectable desktop overlay, real-time audio listening, and personalized AI responses.