Phantom CodePhantom Code
Proof
NEW
Earn with UsHelpBlogsFAQ
Proof
NEW
Earn with UsHelp CenterBlogsFAQMy PromptsFeedbackSubscribe
Phantom CodePhantom Code
Proof
NEW
Earn with UsHelpBlogsFAQ
Proof
NEW
Earn with UsHelp CenterBlogsFAQMy PromptsFeedbackSubscribe
HomeLeetCode ProblemsRepeated DNA Sequences
Used by thousands of developers who passed their interviews

How to Solve Repeated DNA Sequences Problem

Master the Repeated DNA Sequences LeetCode problem with undetectable real-time assistance. Get instant solutions and explanations during your coding interviews.

Phantom Code generates complete solutions and debugging hints that you can use while explaining your approach, so you stay calm and in control.

undetectable
real-time
works on major platforms
WindowsStart Free for Windows
Medium#187
LeetCode Problem

Repeated DNA Sequences

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'. When studying DNA, it is useful to identify repeated sequences within the DNA. Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

Hash TableStringBit ManipulationSliding WindowRolling HashHash Function

Phantom Code will help you solve this problem in real-time during your interview

Get instant solutions, explanations, and code generation
Problem Breakdown

Understanding the Repeated DNA Sequences Problem

Let's break down this LeetCode problem and understand what makes it challenging in interview settings.

Problem Statement

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'. When studying DNA, it is useful to identify repeated sequences within the DNA. Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

MediumProblem #187
LeetCode

Repeated DNA Sequences

Related Topics

Hash TableStringBit ManipulationSliding WindowRolling HashHash Function

How Phantom Code Helps

Get real-time assistance for Repeated DNA Sequences problems during coding interviews. Phantom Code provides instant solutions and explanations.

Examples

# Example 1

Input
s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output
["AAAAACCCCC","CCCCCAAAAA"]

# Example 2

Input
s = "AAAAAAAAAAAAA"
Output
["AAAAAAAAAA"]

Constraints

1 <= s.length <= 105
s[i] is either 'A', 'C', 'G', or 'T'.

How Phantom Code Helps with LeetCode Problems

Reinforce undetectability, platform compatibility, and real-time assistance to remove any doubt.

1000+
developers use Phantom Code
and growing every day
95%
success rate
of users pass their interviews
100%
undetectable
native desktop architecture
Real-time
assistance
instant solutions during interviews

See Phantom Code in Action

Watch how Phantom Code helps solve LeetCode problems during live interviews

Phantom Code
Start Interview
⌘I
Online Round
⌘O
Hide⌘B
Interview
Listening
Think

Solve Repeated DNA Sequences — The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C',...

Here's the optimal approach using Hash Table:

def solve(input):
# Optimal O(n) solution
return result

Time: O(n)  |  Space: O(n)

Start Over ⌘G
Think & Crack ⌘↵

Undetectability Checklist

Run compatibility test before interviews
Use recommended Zoom version settings
Enable advanced screen capture options
Verify native desktop architecture
Test with screen recording software

Platform Compatibility

Zoom
Supported
Google Meet
Supported
HackerRank
Supported
CodeSignal
Supported
CoderPad
Supported
Teams
Supported

User results and traction

Thousands of developers use Phantom Code. Social proof signals that this approach helps real candidates land offers across a range of companies.

Undetectability and technical details

Our native desktop architecture avoids common detection vectors used by browser extensions. We provide a clear checklist so you can run basic checks and confirm the app will be invisible.

Platform compatibility and limitations

We work with Zoom, HackerRank, CodeSignal, CoderPad and other web-based platforms. Check the compatibility note and request a browser link if a specific desktop app is unsupported.

Frequently Asked Questions

Common questions about solving Repeated DNA Sequences and using Phantom Code during coding interviews.

How does Phantom Code help me solve coding problems like Repeated DNA Sequences during interviews?
Phantom Code generates complete solutions instantly with proper complexity analysis, letting you focus on explaining your approach and demonstrating problem-solving skills rather than getting stuck on implementation details during high-pressure situations.
What if the interviewer asks follow-up questions or modifications to problems like Repeated DNA Sequences?
Phantom Code adapts in real-time. Screenshot the modified problem or use audio mode to capture the interviewer's follow-up, and get an updated solution within seconds — including edge cases and optimizations.
Can Phantom Code help me communicate my solution for problems like Repeated DNA Sequences?
Yes. Phantom Code provides step-by-step approach explanations with 3 progressive thoughts, so you can walk through your solution naturally. It also provides time and space complexity analysis to discuss trade-offs.
How does Phantom Code assist with different programming languages for Repeated DNA Sequences type problems?
Phantom Code supports 11 programming languages including Python, Java, C++, JavaScript, TypeScript, Go, Rust, Ruby, Swift, Kotlin, and C#. Set your preferred language and get idiomatic solutions.
What coding mistakes does Phantom Code help me avoid during Repeated DNA Sequences interviews?
Phantom Code catches common mistakes like off-by-one errors, missing edge cases, incorrect base conditions, and suboptimal approaches. It provides clean, well-structured code that handles all edge cases.
Is Phantom Code detectable when solving problems like Repeated DNA Sequences during live interviews?
No. Phantom Code runs as an invisible desktop overlay that doesn't appear in screen shares, recordings, or proctoring software. It works with Zoom, HackerRank, CodeSignal, CoderPad, and all major platforms.
How does Phantom Code help when I'm struggling with Repeated DNA Sequences style questions under pressure?
The AI provides structured guidance: first the approach (what algorithm/data structure to use and why), then the implementation with clean code, and finally complexity analysis. This helps you think clearly even under pressure.
Does Phantom Code work for the coding platforms used in Repeated DNA Sequences interviews?
Yes. Phantom Code works with all major coding platforms including LeetCode, HackerRank, CodeSignal, CoderPad, HackerEarth, and any browser-based coding environment.
Phantom Code

₹999/month. Zero Detection Cases.

The only AI interview tool with an undetectable desktop overlay, real-time audio listening, and personalized AI responses.

WindowsStart Free for Windows
Phantom CodePhantom Code
Phantom Code is an undetectable desktop application to help you pass your Leetcode interviews.
All systems online

Legal

Refund PolicyTerms of ServiceCancellation PolicyPrivacy Policy

Pages

Contact SupportHelp CenterFAQBlogPricingFeedbackLeetcode ProblemsLoginCreate Account

Compare

Interview Coder AlternativeFinal Round AI AlternativeUltraCode AI AlternativeParakeet AI AlternativeAI Apply AlternativeCoderRank AlternativeInterviewing.io AlternativeShadeCoder Alternative

Resources

Salary GuideResume Templates

Interview Types

Coding InterviewSystem Design InterviewDSA InterviewLeetCode InterviewAlgorithms InterviewData Structure InterviewSQL InterviewOnline Assessment

© 2026 Phantom Code. All rights reserved.